Vedanta Demerger: New Shares Credited to Demat Accounts? Here’s What Investors Should Watch Before Listing Day (Image: Shutterstock) Just a day after the listing of the 4 demerged entities of the ...
A secret society is at risk of falling into the hands of an enemy force that could threaten the very existence of humanity. The adventure awaits just around the corner. The only catch … you are the ...
PHOENIX — One person is dead after a shooting involving police officers in north Phoenix on Thursday evening. Phoenix police confirmed the shooting just before 6 p.m. near Interstate 17 and Pinnacle ...
The Oxygen SR3 Scout Rifle is a classic Destiny 2 weapon reprised in the Edge of Fate expansion, and the god rolls you want for PvE and PvP are wildly different. It can be effective in both modes, but ...
The fourth edition of the e4m CTV Conference is set to take place in Mumbai on June 11, bringing together industry experts, marketers, advertisers and business leaders from across the media and ...
I’ve been working with computers for ages, starting with a multi-year stint in purchasing for a major IBM reseller in New York City before eventually landing at PCMag (back when it was still in print ...
Congrats! You’ve made it to the final chapter, but you still have a tough fight ahead of you. After the chapter's opening cutscenes, you'll find yourself back in Kamurocho. Your first destination is ...
Haier 1.5 Ton 4 Star Triple Inverter Split AC (5250 W, Copper, 7 in 1 Convertible, 4-Way Swing, Frost Self Clean, HD Filter, Cools at 60°C, 20 Mtr. Air Throw - HSU18K-PYSC4BN-INV, White)View Details ...
A reverse primer designed from EST aa306952 (5′–CGTAACACTCCATGGAAATCAGC–3′) and a forward primer designed from the ORF upstream to EST aa306952 (5′–ATGAAGGATGTTATGTCAGCTCTGT–3′) were used to amplified ...