The accessibility tree decides whether an AI agent can read and act on your page. The 2026 data says the web is getting ...

Hidden Attribution Markers Found in Anthropic Claude Code Anthropic's AI model has been found to contain hidden tracking mechanisms targeting Chinese users within system prompts and code. Gabrielle ...

OrcaRouter, the OpenAI-compatible LLM gateway, today published The AI Threat Report 2026 and made two of its security controls available at no cost to all users: the agent Firewall and input/output ...

Spread the love“`html 1. Understanding GZIP Compression GZIP compression is a technique that dramatically reduces the size of files sent from your web server to a user’s browser. This compression is ...

A five-character fix turned a failing Lighthouse Agentic Browsing audit into a clean pass. What that reveals about what the audit actually measures.

Backstage solved the portal problem, not the platform problem. A portal organizes catalogs, documentation, and templates. A ...

Modern browsers let you share a link that jumps straight to whatever text you wish to highlight. Here’s how the feature works.

Morningstar Quantitative Ratings for Stocks are generated using an algorithm that compares companies that are not under analyst coverage to peer companies that do receive analyst-driven ratings.

A reverse primer designed from EST aa306952 (5′–CGTAACACTCCATGGAAATCAGC–3′) and a forward primer designed from the ORF upstream to EST aa306952 (5′–ATGAAGGATGTTATGTCAGCTCTGT–3′) were used to amplified ...

SpaceX is set to make history with a record-setting $1.77 trillion valuation at its IPO. The company had previously been expected to IPO at a valuation of as much as $2 trillion.

Michael J. Fox is set to voice lead character Dougie in the upcoming CG animated feature film “Dragoons” from Icon Creative Studios. Per the official description, Dougie is “an overlooked, ordinary ...

If you’ve read anything about technology in the last few years, you may have seen the term “encryption” floating around. It’s a simple concept, but the realities of its use are enormously complicated.